Stanford University| Biochemistry| Stanford Genome Technology Center  

Home

DHPLC

Mass Spectrometry

Publications

Patents & Technology Transfer

mtDNA

Contact Information

Private Resources

Links

 

List of primers used for resequencing the mitochondrial genome

GENBANK_MT_1F GGTATGCACTTTTAACAGTCACC 412-435
GENBANK_MT_1R ACTTGGGTTAATCGTGTGACC 901-921
GENBANK_MT_2F CAGGGTTGGTCAATTTCGT 870-888
GENBANK_MT_2R TCATAAGGGCTATCGTAGTTTTC 1380-1402
GENBANK_MT_3F GTGGCAAGAAATGGGCTAC 1348-1366
GENBANK_MT_3R TCTAGTTAATTCATTATGCAGAAGG 1845-1869
GENBANK_MT_4F AAGCATAATATAGCAAGGACTAACC 1814-1838
GENBANK_MT_4R ATGCGGAGGAGAATGTTTTC 2317-2336
GENBANK_MT_5F AACATATAACTGAACTCCTCACACC 2238-2262
GENBANK_MT_5R CCATAGGGTCTTCTCGTCTTG 2713-2733
GENBANK_MT_6F TTTAACCAGTGAAATTGACCTG 2665-2686
GENBANK_MT_6R CCTTATTTCTCTTGTCCTTTCGT 3125-3147
GENBANK_MT_7F TTTCTATCTACCTTCAAATTCCTC 3096-3119
GENBANK_MT_7R GGGTTTTAGGGGCTCTTTG 3477-3495
GENBANK_MT_8F CTACAACCCTTCGCTGACG 3442-3460
GENBANK_MT_8R GTTGGTCTCTGCTAGTGTGGAG 3867-3888
GENBANK_MT_9F GCCATAATATGATTTATCTCCACA 3850-3873
GENBANK_MT_9R TATCAAAGTAACTCTTTTATCAGACAT 4268-4295
GENBANK_MT_10F CCATACCCATTACAATCTCCAG 4223-4244
GENBANK_MT_10R GATTATGGATGCGGTTGCT 4658-4676
GENBANK_MT_11F AAACCCTCGTTCCACAGAA 4613-4631
GENBANK_MT_11R AATAGTTAAATTAAGAATGGTTATGTT 5064-5090
GENBANK_MT_12F GATGAATAATAGCAGTTCTACCGT 5032-5055
GENBANK_MT_12R GATGAGTGTGGGGAGGAATGG 5439-5459
GENBANK_MT_13F CAACGTAAAAATAAAATGACAGTT 5396-5419
GENBANK_MT_13R TGTAAATCTAAAGACAGGGGTTA 5841-5863
GENBANK_MT_14F ATATGAAAATCACCTCGGAGC 5805-5825
GENBANK_MT_14R GGTAGACTGTTCAACCTGTTCC 6270-6291
GENBANK_MT_15F GCTCGCATCTGCTATAGTGG 6239-6258
GENBANK_MT_15R AGTTACAATATGGGAGATTATTCC 6657-6680
GENBANK_MT_16F CACAGCAGTCCTACTTCTCCTAT 6473-6495
GENBANK_MT_16R GGTGAAAAGAAAGATGAATCCTA 6928-6950
GENBANK_MT_17F AGCATATTTCACCTCCGCTAC 6809-6829
GENBANK_MT_17R TATTACTGCTGTTAGAGAAATGAATG 7276-7301
GENBANK_MT_18F ACCCCGATGCATACACCA 7231-7248
GENBANK_MT_18R GGACTAGGAAGCAGATAAGGAAA 7678-7700
GENBANK_MT_19F CGCAAGTAGGTCTACAAGACG 7599-7619
GENBANK_MT_19R ATCTGTTTTTAAGCCTAATGTGG 8082-8104
GENBANK_MT_20F CTAATCTTCAACTCCTACATACTTCC 7931-7956
GENBANK_MT_20R GCCATACGGTAGTATTTAGTTGG 8371-8393
GENBANK_MT_21F AAGATTAAGAGAACCAACACCTCT 8332-8355
GENBANK_MT_21R GTGGCAATAAAAATGATTAAGGA 8746-8768
GENBANK_MT_22F ACAACACTAAAGGACGAACCTG 8707-8729
GENBANK_MT_22R GCATGTGATTGGTGGGTCA 9208-9226
GENBANK_MT_23F TCATCTTCACAATTCTAATTCTACTG 9098-9123
GENBANK_MT_23R TGATGCGAGTAATACGGATGTG 9605-9626
GENBANK_MT_24F ATTTCACTTCCACTCCATAACG 9308-9329
GENBANK_MT_24R TAGTGAGGAAAGTTGAGCCAAT 9834-9855
GENBANK_MT_25F TCGAGTCTCCCTTCACCATT 9751-9770
GENBANK_MT_25R GGTAAAAGGAGGGCAATTTCT 10259-10279
GENBANK_MT_26F CGGCTTCGACCCTATATCC 10175-10193
GENBANK_MT_26R CTAGTATGGCAATAGGCACAATA 10640-10662
GENBANK_MT_27F CTACTCTCATAACCCTCAACACC 10600-10622
GENBANK_MT_27R ATAGAGAGGTAGAGTTTTTTTCGTG 11028-11052
GENBANK_MT_28F AGCCAACGCCACTTATCC 10997-11014
GENBANK_MT_28R AGGGGTAGGCTATGTGTTTTG 11520-11540
GENBANK_MT_29F GCCGCAGTACTCTTAAAACTAGG 11453-11475
GENBANK_MT_29R TGTAGAGGGAGTATAGGGCTGTG 11965-11987
GENBANK_MT_30F AGGACTCAACATACTAGTCACAGC 11947-11970
GENBANK_MT_30R GTCTAGGCACATGAATATTGTTGT 12487-12510
GENBANK_MT_31F TTACCACCCTCGTTAACCCT 12395-12414
GENBANK_MT_31R GCTGTGTTGGCATCTGCTC 12818-12836
GENBANK_MT_32F TATATCCTTCTTGCTCATCAGTTG 12783-12806
GENBANK_MT_32R GAGTCCTAGTTGACTTGAAGTGG 13250-13272
GENBANK_MT_33F CTTCCACCCCCTAGCAGA 13122-13139
GENBANK_MT_33R GTGAGAAGAATTATTCGAGTGCT 13603-13625
GENBANK_MT_34F AAAGACCACATCATCGAAACC 13510-13530
GENBANK_MT_34R AAATCCTGCGAATAGGCTTC 13715-13734
GENBANK_MT_35F CTAACAGGTCAACCTCGCTTCC 13627-13648
GENBANK_MT_35R AGATAGGGGATTGTGCGGTG 13936-13955
GENBANK_MT_36F CAGCCCTAGACCTCAACTACC 13835-13855
GENBANK_MT_36R AAATTGTTTTAGGTAATAGCTTTTCT 14010-14035
GENBANK_MT_37F GCACAATCCCCTATCTAGGC 13940-13959
GENBANK_MT_37R TTCGTCCTGTGGGTGAAAG 14352-14370
GENBANK_MT_38F CCTTCATAAATTATTCAGCTTCCT 14288-14311
GENBANK_MT_38R GAGGTCGATGAATGAGTGGTT 14789-14809
GENBANK_MT_39F CAATGATATGAAAAACCATCGTT 14701-14723
GENBANK_MT_39R GGATGGCGGATAGTAAGTTTGT 15185-15206
GENBANK_MT_40F GCCTATATTACGGATCATTTCTCT 15048-15071
GENBANK_MT_40R GGTGTTTAAGGGGTTGGCTA 15519-15538
GENBANK_MT_41F CTTACTTCTCTTCCTTCTCTCCTTA 15439-15463
GENBANK_MT_41R GCTTCCCCATGAAAGAACA 16022-16040

top of page

  mail to webmaster
last updated 06/25/2002 | © Stanford Genome Technology Center